Distribution and Genetic Differentiation of Macrobrachium Jelskii

Loading...

J OURNAL OF C RUSTACEAN B IOLOGY, 36(3), 373-383, 2016

DISTRIBUTION AND GENETIC DIFFERENTIATION OF MACROBRACHIUM JELSKII (MIERS, 1877) (NATANTIA: PALAEMONIDAE) IN BRAZIL REVEAL EVIDENCE OF NON-NATURAL INTRODUCTION AND CRYPTIC ALLOPATRIC SPECIATION Ana Luiza Vera-Silva 1 , Fabrício L. Carvalho 2 , and Fernando L. Mantelatto 1,∗ 1 Laboratory

of Bioecology and Crustacean Systematics (LBSC), Department of Biology, Faculty of Philosophy, Science and Letters at Ribeirão Preto (FFCLRP), University of São Paulo (USP), Avenida Bandeirantes 3900, 14040-901, Ribeirão Preto, São Paulo, Brazil 2 Instituto de Humanidades Artes e Ciências Jorge Amado (IHAC-JA), Universidade Federal do Sul da Bahia (UFSB), Rod. Ilhéus-Vitória da Conquista, BR 415, km 30, 45613-204, Ferradas, Itabuna, Bahia, Brazil ABSTRACT Macrobrachium jelskii (Miers, 1877) occurs in all major Brazilian drainage basins. Considering its wide distribution and the supposed isolation of certain populations, we evaluated phylogenetic relationships among populations from several river basins. Analyses of molecular data using the mitochondrial COI and 16S genes suggest the division of the species into two clades, “Amazonian” and “coastal.” The genetic divergence between these two groups is greater than the genetic divergence within the respective groups. Based on the time of divergence and the probable natural distribution of the species, we suggest two evolutionary scenarios to explain the origin of the coastal clade. The first scenario considers the capacity of M. jelskii to tolerate saline environments. The second is based on Pliocene climate changes that would have caused river confluence from sea level regression. The two clades occur sympatrically but this is a recent condition. The wide geographic distribution and low genetic divergence of the Amazonian clade allows us to propose that the current distribution of M. jelskii is partly due to human activity. Pending future analysis, the absence of a consistent morphological synapomorphy precludes the description of a new cryptic taxonomic entity for M. jelskii.

K EY W ORDS: 16S rRNA, Caridea, COI, freshwater shrimps, human activities DOI: 10.1163/1937240X-00002425 I NTRODUCTION Macrobrachium Spence Bate, 1868, placed in the family Palaemonidae Rafinesque, 1815, is one of the most speciesrich freshwater shrimp groups, being distributed in tropical and subtropical areas around the world (Holthuis, 1980). There are 19 species of Macrobrachium found in Brazil, 17 are native and two were introduced (Magalhães et al., 2005; Maciel et al., 2011; Pileggi and Mantelatto, 2012). Two strongly marked characters shown by several species, low interspecific morphological variability, and high intraspecific variability have been raising doubts about the taxonomic status of some species (Pileggi and Mantelatto, 2010). Molecular data have therefore become an important tool for the elucidation of complex taxonomic, phylogenetic, and phylogeographic relationships in this very diverse taxon, as analyses of morphological characters alone are not enough (Liu et al., 2007; Baker et al., 2008; Pileggi and Mantelatto, 2010; Vergamini et al., 2011; Rossi and Mantelatto, 2013). Macrobrachium jelskii (Miers, 1877) is a species endemic to South America, occurring in Venezuela, Trinidad, Suriname, the Guianas, Peru, Bolivia, Argentina, and Brazil. It occurs in all major river basins in Brazil: the Amazon, Tocantins/Araguaia, São Francisco, and Paraná/Paraguay ∗ Corresponding

river basins (Magalhães et al., 2005; Boos et al., 2012; Pileggi et al., 2013) as well as several coastal basins. Macrobrachium jelskii has abbreviated larval development, and therefore its dispersion capacity is considered to be limited compared to other species with extended larval development (Gamba, 1984; Jalihal et al., 1993; Magalhães, 2002). Macrobrachium jelskii is an important component of the limnic trophic web being exclusively found and abundant in freshwater environments. It is also economically important in the aquarium trade, artisanal fishing bait, and protein source for humans and other animals (Soares, 2008; Ottoni et al., 2011; Barros-Alves et al., 2012). Recreational fishing, storage of shrimps for aquaculture, the release of live bait, and the existence of illegal crops can also be considered causes for the introduction of this species in non-native areas (Eno et al., 1997; Gazola-Silva et al., 2007; Gozlan, 2008), which suggests human activity could be partly responsible for the known records of M. jelskii. Its wide distribution (being natural or introduced) and the characteristics of its life cycle (with low capacity of dispersion) allow us to hypothesize that the morphological and molecular variability among populations of M. jelskii along Brazilian drainages are compatible with interspecific variations due to allopatric speciation. The identification of in-

author; e-mail: [email protected]

© The Crustacean Society, 2016. Published by Brill NV, Leiden Downloaded from http://academic.oup.com/jcb/article-abstract/36/3/373/2548970 by guest on 13 April 2018

DOI:10.1163/1937240X-00002425

374

JOURNAL OF CRUSTACEAN BIOLOGY, VOL. 36, NO. 3, 2016

traspecific groups has already been reported in Brazil for some species of Macrobrachium, such as M. amazonicum (Heller, 1862) (Vergamini et al., 2011) and Macrobrachium potiuna (Müller, 1880) (Carvalho et al., 2013). These examples reinforce the possibility that a similar situation could happen to M. jelskii, once its natural distribution reaches that of M. amazonicum (Magalhães et al., 2005; Vergamini et al., 2011). These populations have not been evaluated from a molecular and phylogenetic perspective. The objective of this study was to describe the genetic variability of M. jelskii from Brazilian river basins and evaluate the existence of cryptic, phylogenetically related species not yet described in order to explain the current distribution of the species.

M ATERIALS AND M ETHODS Sampling and Morphological Analysis Specimens were obtained from field collections over almost the complete distribution of the species in Brazil (Fig. 1) and loans and donations from different collections. The collections complied with current applicable state and federal Brazilian laws (FLC authorization from ICMBio No. 25329 and permanent license to FLM for the collection of Zoological Material No. 11777-1 MMA/IBAMA). We performed prior identification of the material based on diagnostic morphological characteristics of the species (Holthuis, 1952; Melo, 2003). Morphological analyses for clade differentiation within M. jelskii were performed based on diagnostic characters traditionally used for the family (Holthuis, 1952; Pereira, 1997; De Grave and Ashelby, 2013; Carvalho et al., 2014).

Fig. 1. Localities where the specimens of Macrobrachium jelskii used in the study were collected. This figure is published in colour in the online edition of this journal, which can be accessed via http://booksandjournals.brillonline.com/content/journals/1937240x.

Downloaded from http://academic.oup.com/jcb/article-abstract/36/3/373/2548970 by guest on 13 April 2018

375

VERA-SILVA ET AL.: DISTRIBUTION AND GENETIC DIFFERENTIATION IN MACROBRACHIUM JELSKII

Molecular Data Nucleotide sequences were obtained based on protocols described by Schubart et al. (2000), modified by Mantelatto et al. (2007) and Pileggi and Mantelatto (2010). Some modifications were done to adapt to our material. DNA Extraction Adult individuals were selected whenever possible. Genetic vouchers, which were extracted from tissue samples for analyses, were deposited at Coleção de Crustáceos do Departamento de Biologia (CCDB), Faculdade de Filosofia, Ciências e Letras de Ribeirão Preto (FFCLRP), Universidade de São Paulo (USP) (Table 1). Genomic DNA was extracted from muscle tissue of the abdomen of selected individuals. The tissue was incubated for 24 h in 600 μl of lysis buffer at 55°C with the addition of 200 μl of proteinase K (approximately 500 μg/ml; Thermo Scientific, Rockford, IL, USA), followed by 200 μl of ammonium acetate (7.5 M), and the sample was centrifuged at 14,000 rpm for 10 minutes at 18°C. The supernatant was collected and transferred to 600 μl of isopropanol. The resulting sample was centrifuged at 14,000 rpm for 10 minutes at 18°C and kept in a freezer at −20°C. After 24 to 48 h the sample was centrifuged again at 14,000 rpm for 10 minutes at 18°C and the supernatant discarded. The resulting residue (pellet) was washed with ethanol 70%, dried, and resuspended in 30 μl of TE 1× buffer. The extracted DNA concentration was measured by spectrophotometer (NanoDrop® 2000/2000c, Wilmington, DE, USA).

DNA Amplification The regions of interest (fragments of the mitochondrial genes 16S rRNA and cytochrome c oxidase subunit I (COI)) were amplified by PCR (Polymerase Chain Reaction). The PCR products were obtained in reactions of 25 μl containing 6.5 μl of deionized water, 5 μl of 5 M betaine, 3 μl of 10× PCR buffer, 3 μl of 25 mM MgCl2 , 4 μl of 0.25 μM each DNTP, 2 μl of primer (1 μl of each, 16S-1472 4.59 nmol/OD (AGATAGAAAC CAACCTGG), 16S-L2 4.44 nmol/OD (TGCCTGTTTATCAAAAACAT), HCOI 3.18 nmol/OD (TAAACTTCAGGGTGACCAAAAAATCA), and LCOI 3.41 nmol/OD (GGTCAACAAATCATAAAGATATTGG) (Folmer et al., 1994; Crandall and Fitzpatrick, 1996; Schubart et al., 2002)), 0.5 μl of Taq DNA recombinant polymerase (5 U/μl, Thermo Scientific, Waltham, MA, USA), and 1 μl of DNA at 10 ng/μl for 16S and 80 ng/μl for COI. The amplification was performed in an Applied Biosystems (Foster City, CA, USA) Veriti 96 Well Thermal Cycler® (thermal cycles: initial denaturing for 5 min at 95°C; pairing for 40 cycles: 45 s at 95°C, 45 s at 52°C, 1 min at 72°C; final extension 3 min at 72°C for 16S rRNA; and initial denaturing for 2 min at 94°C; pairing for 40 cycles: 30 s at 94°C, 30 s at 42-46°C, 1 min at 72°C; final extension 10 min at 72°C for COI). Electrophoresis was performed using 1.5% agarose gel with PCR product. We photographed the results with a digital camera C-7070 Olympus® in a transilluminator UV M20 UVP® .

Table 1. Specimens of Macrobrachium jelskii used in phylogenetic analyses, sampling locality, and CCDB (Coleção de Crustáceos do Departamento de Biologia, Universidade de São Paulo, Brazil) catalog numbers. Notations “II,” “III” and “IV” were assigned to specimens with the same catalog number to allow individuals to be distinguished; ∗ Pileggi and Mantelatto (2010); ∗∗ Carvalho et al. (2013).

Species

M. jelskii

Outgroups M. amazonicum M. brasiliense M. potiuna

Locality

Catalog number

GenBank accession number 16S

COI

Córrego na rodovia, Castanhal, Pará Igarapé, Senador José Porfírio, Pará Riacho do Brejinho, Caxias, Maranhão Açude Bengue, Aiuaba, Ceará Açude Sabiá, Juazeiro do Norte, Ceará Rio Piranhas, São Bento, Paraíba Rio Itamirim, Sergipe Rio Inhambupe, Bahia Ilha de Itaparica, Vera Cruz, Bahia Rio Vermelho, Elísio Medrado, Bahia Mutuípe, Bahia Rio de Contas, Bahia Rio Tijuípe, Itacaré, Bahia Rio Pancadinha, Uruçuca, Bahia Rio Jacão, Una, Bahia Rio Jacão, Una, Bahia (II) Estação Veracel, Porto Seguro, Bahia Córrego da Lagoa Grande, Prado, Bahia Rio Jucuruçu afluente, Prado, Bahia (II) Rio São Francisco, Januária, Minas Gerais Pirapitinga, Três Marias, Minas Gerais Lagoa Grande, Vila Velha, Espirito Santo Lagoa Grande, Vila Velha, Espirito Santo (IV) Córrego Sete, Vila Velha, Espirito Santo (II) Córrego Sete, Vila Velha, Espirito Santo (III) Lagoa de Maeaípe, Guarapari, Espirito Santo Córrego Caranguejo, Cardoso Moreira, Rio de Janeiro Pureza, Cambuci, Rio de Janeiro Pereira Barreto, São Paulo Clube Náutico de Araraquara, Araraquara, São Paulo

CCDB 4337 CCDB 4992 CCDB 1578 CCDB 4569 CCDB 4712 CCDB 4568 CCDB 4567 CCDB 4566 CCDB 2625 CCDB 3794 CCDB 3796 CCDB 2788 CCDB 1566 CCDB 1254 CCDB 3087-1 CCDB 3087-2 CCDB 1657 CCDB 4203 CCDB 4201 CCDB 549 CCDB 2952 CCDB 2627-1 CCDB 2627-2 CCDB 2628-1 CCDB 2628-2 CCDB 2842 CCDB 4991 CCDB 4650 CCDB 2129 CCDB 3520

KP054355 KP054349 KP054340 KP054350 KP054345 KP054343 KP054361 KP054344 KP054364 KP054339 KP054347 KP054356 – KP054352 KP054360 – KP054351 KP054342 KP054354 KP054346 KP054341 KP054358 KP054365 KP054359 KP054362 KP054363 KP054348 KP054353 KP054357 KP054338

– KP054337 – KP054323 KP054327 KP054321 KP054332 KP054322 KP054328 KP054335 KP054319 KP054317 KP054326 KP054320 KP054331 KP054329 – KP054324 KP054316 – – – – KP054334 KP054333 KP054330 KP054325 KP054318 – KP054336

Aquidauana, Mato Grosso do Sul Rio Claro, Serra Azul, São Paulo Iguape, São Paulo

CCDB 1970 CCDB 2135 CCDB 2496

HM352442∗ HM352429∗ JX466934∗∗

– KP054314 KP054315

Downloaded from http://academic.oup.com/jcb/article-abstract/36/3/373/2548970 by guest on 13 April 2018

376

JOURNAL OF CRUSTACEAN BIOLOGY, VOL. 36, NO. 3, 2016

Purification and Sequencing Plus®

kit (Bioline, We purified the PCR products using the SureClean Taunton, MA, USA), following the manufacturer’s instructions. The sequencing of the samples was performed in automated sequencer (ABI 3730 XL DNA Analyzer® , Applied Biosystems, Foster City, CA, USA) at Departamento de Tecnologia da Faculdade de Ciências Agrárias e Veterinárias de Jaboticabal, Universidade Estadual Paulista “Júlio de Mesquita Filho,” with the reaction kit ABI Big Dye® Terminator Mix (Applied Biosystems). Editing Sequences Both DNA strands (sense and antisense) were sequenced for higher reliability in the obtained sequences. The sequence of each strand was edited to generate a consensus sequence using the computational program BioEdit v7.0.5 (Hall, 2005). The sequence alignment was conducted in the software MAFFT v7.158 (Katoh and Standley, 2013), using the default setting. Phylogenetic Analysis Uncorrected genetic divergences (p-distance) were calculated using the MEGA 6 program (Tamura et al., 2011). Statistical selection of nucleotide substitution models were conducted in jModelTest v2.1.4 (Darriba et al., 2012). Bayesian analyses were conducted in MrBayes v3.2.2 program (Ronquist et al., 2012). The nucleotide substitution model initially used was GTR +  + I. We also performed analyses with simpler models: TPM2u + I for 16S and HKY +  for COI. These models were selected using Bayesian Information Criterion (BIC), chosen from among jModelTest available models. BIC provided the values of the parameters for analysis (frequency of nucleotides and transition/transversion ratio, gamma distribution and variable sites proportion, when it was present in the model). These values were used to set a priori model parameters in MrBayes. Analyses were performed with 106 generations in two independent parallel simulations with four chains each and were stopped when they reached stationarity (average standard deviation between two simulations less than 0.01). The parameter values were saved once every 1000 rounds. The first quarter of the parameters and trees were discarded. Only nodes with a posteriori probability higher or equal to 50% were shown (see Ronquist et al., 2012). Initial analyses were performed using 16S and COI matrices separately. Analysis of the concatenate matrix of both genes of interest was also conducted in MrBayes program. Data were divided into two independent partitions, each following the simplest model that best applied to each gene (TPM2u + I for 16S and HKY +  for COI), with parameters provided by jModelTest. This analysis was initially performed with all sequences obtained in this study, but it was not possible to obtain sequences of both genes for all individuals. Initial analysis thus included 16S sequences without 100% of the corresponding COI and vice versa, i.e., COI sequences without 100% of the corresponding 16S. Analysis was also performed only with sequences from individuals who had sequences for both genes. Maximum likelihood analyses were conducted in the RAxML program (7.6.3) (Stamatakis, 2006) and implemented in Cyberinfrastructure for Phylogenetic Research (CIPRES; available on line at http://www.phylo. org). The assumed nucleotide substitution model was GTR +  + I. The consistency of the topologies was measured by bootstrap method (1000 pseudoreplicates), and only confidence values higher than 50% were reported. This analysis was performed for the genes 16S and COI separately and for a concatenate matrix of both. The majority rule consensus tree between Bayesian inference method and maximum likelihood was obtained using the software Mesquite v3.01 (Maddison, 2003). Molecular Dating Likelihood ratio test (LRT) was performed in order to test the null hypothesis that data evolved under a molecular clock, which was accepted (p > 0.05). Likelihood values for the molecular trees obtained by means of Bayesian inference with and without an imposed molecular clock (both using the models TPM2u + I and HKY + ) were compared using a LRT calculator in jModelTest. We therefore used a strict molecular clock in order to estimate the approximate divergence time between M. jelskii clades. We assumed mutation rates per site per million years for corrected values of divergence of 0.007 (± 0.00133) for 16S and 0.0120 (± 0.00169) for COI. To obtain these rates, the molecular clock was calibrated with two groups

Downloaded from http://academic.oup.com/jcb/article-abstract/36/3/373/2548970 by guest on 13 April 2018

of palaemonid species with known divergence time: Palaemon carteri (Gordon, 1935), Palaemon ivonicus (Holthuis, 1950), and Palaemon yuna Carvalho, Magalhães and Mantelatto, 2014, from 9.5 Ma, and Palaemon paivai Fausto Filho, 1967 and Palaemon ritteri Holmes, 1895, from 3 Ma (see Carvalho et al., 2014). The calibration points were then removed and several mutation rates were tested. We selected the rates that resulted in divergence times that were closest to those obtained with calibration points.

R ESULTS We obtained approximately 1130 bp of sequence, i.e., 16S partial sequence (about 550 bp) of 28 individuals of M. jelskii from 26 locations as well as specimens of three congeners (M. amazonicum, M. brasiliense (Heller, 1862) (from Pileggi and Mantelatto, 2010), and M. potiuna (from Carvalho et al., 2013)), and the partial sequences of COI (about 580 bp) of 22 individuals of M. jelskii from 20 locations and two other species of Macrobrachium (M. potiuna and M. brasiliense). The topology showed the presence of two groups within the species, here named “Amazonian clade” (consisting of specimens from all sampled regions) and “coastal clade” (consisting of some specimens from eastern Brazilian basins in the states of Sergipe, Bahia, and Espírito Santo). These names were chosen because they refer to the likely natural distribution of each clade. Both Bayesian inference analysis and maximum likelihood showed the monophyly of these two groups, based on 16S rRNA, COI and on the concatenated sequences of the two genes (Fig. 2). None of the substitution models used (GTR +  + I and TPM2u + I for 16S and GTR +  + I and HKY +  for COI) resulted in significant differences in the tree topologies obtained by Bayesian inference. Only a slight variation in the clades support values was shown. The concatenated analysis that includes 16S sequences without a COI correspondent and COI sequences without a 16S correspondent did not present differences in tree topologies compared to the analysis done only with sequences from individuals who had sequences for both genes. The intraspecific genetic divergence of M. jelskii ranged from 0.0 to 3.6% for 16S and from 0.0 to 10.0% for COI. Genetic divergence between the two groups ranged from 2.3 to 3.6% for 16S and from 6.0 to 10.0% for COI. Genetic divergence among specimens of the Amazonian clade varied from 0.0 to 1.6% for 16S and from 0.0 to 3.2% for COI. In the coastal clade, this variation was 0.0% for 16S and from 0.0 to 0.5% for COI (Figs. 3 and 4). The time of divergence between the two clades (based on 16S rRNA and COI genes) was estimated to be approximately 3 million years. This average ranged from approximately 2.5 to approximately 3.5 Ma and was lower in 16S analysis than in COI analysis. The 95% credibility confidence interval (HPD, or highest posterior density) ranged from 1.7 to 3.7 Ma for 16S, 2.4 to 4.4 Ma for COI, and from 2.3 to 4.3 for concatenate analysis, using a strict molecular clock (Fig. 5). These data indicate that the divergence between the Amazonian and coastal clades occurred in the Pliocene. D ISCUSSION Molecular analysis showed the existence of two clades, Amazonian and coastal, of M. jelskii. The Amazonian clade

VERA-SILVA ET AL.: DISTRIBUTION AND GENETIC DIFFERENTIATION IN MACROBRACHIUM JELSKII

377

Fig. 2. Consensus tree between Bayesian inference (TPM2u + I and HKY +  models) and maximum likelihood for the genes 16S and COI concatenated. Node numbers represent the a posteriori probability for Bayesian inference and bootstrap values for maximum likelihood, respectively; ∗ individuals that only had 16S sequences, ∗∗ individuals that only had COI sequences. Abbreviations for Brazilian states: PA, Pará; SP, São Paulo; BA, Bahia; MA, Maranhão; MG, Minas Gerais; PB, Paraíba; CE, Ceará; RJ, Rio de Janeiro; ES, Espírito Santo.

is distributed in both coastal and interior areas, including the states of Pará, Maranhão, Ceará, Paraíba, Minas Gerais, and São Paulo, and areas closer to the coast of the states of Bahia and Rio de Janeiro. The coastal clade is exclusively distributed in coastal areas of Sergipe, Bahia and Espirito Santo states (Fig. 6). Although the two clades occur sympatri-

cally today, they underwent an allopatric speciation process during the Pliocene. We propose two sets of events to explain the current distribution of M. jelskii: ancient and recent events. The ancient events clarify the divergence between the coastal and Amazonian clades and recent events explain the occurrence of the Amazonian clade in several areas.

Fig. 3. Uncorrected genetic divergence values (p-distance) interlineage and intralineage for Amazonian and coastal clades of Macrobrachium jelskii based on gene 16S.

Fig. 4. Uncorrected genetic divergence values (p-distance) interlineage and intralineage for Amazonian and coastal clades of Macrobrachium jelskii based on gene COI.

Downloaded from http://academic.oup.com/jcb/article-abstract/36/3/373/2548970 by guest on 13 April 2018

378

JOURNAL OF CRUSTACEAN BIOLOGY, VOL. 36, NO. 3, 2016

Fig. 5. Tree obtained by Bayesian inference for the genes 16S and COI concatenated (TMP2u + I and HKY +  models, respectively). Node numbers represent the divergence time in million years, and the bars represent the highest posterior density – HPD. Abbreviations for Brazilian states: PA, Pará; SP, São Paulo; BA, Bahia; MA, Maranhão; MG, Minas Gerais; PB, Paraíba; CE, Ceará; RJ, Rio de Janeiro; ES, Espírito Santo. This figure is published in colour in the online edition of this journal, which can be accessed via http://booksandjournals.brillonline.com/content/journals/1937240x.

Ancient Events We consider the Amazonian region as the likely center of origin of the M. jelskii lineage. Marine incursions of the Miocene onto northern South America enabled the invasion of marine organisms in this area, the Pebas system. Hololimnetic lineages of Macrobrachium arose from lineages of those immigrants that were trapped in inland waters during the later regressions and could survive to the gradually changing environment (see Anger, 2013). The protoAmazon-Orinoco basin and adjacent basins (such as modern upper Paraguay and Paraná basins) can therefore be considered the dispersion center of some marine derived lineages, such as the species of Macrobrachium. This species is known from several Brazilian river basins, but Magalhães et al. (2005) proposed that the natural distribution includes the Orinoco, Amazon, Paraguay, and low Paraná basins. The divergence of the two M. jelskii lineages occurred during the Pliocene, as indicated from our molecular clock analysis. This result is due to the low genetic distances verified between the two groups, which indicate recent divergence of the lineages. The same divergence pattern was suggested for the congeners M. amazonicum and M. potiuna, which show genetic structuration similar to M. jelskii (Vergamini et al., 2011; Carvalho et al., 2013).

Downloaded from http://academic.oup.com/jcb/article-abstract/36/3/373/2548970 by guest on 13 April 2018

Based on the above evidence, and considering both the Amazonian region as the likely dispersion center of M. jelskii and the estimated time of divergence, we suggest two evolutionary scenarios for the divergence into the Amazonian and coastal clades. Both scenarios demand the movement of M. jelskii from the Amazon basin to the northeastern coast of Brazil. The first one takes into account the capacity, although limited, of M. jelskii to tolerate seawater (Holthuis, 1980). From the Amazon basin, M. jelskii would have colonized the eastern Brazilian basins through coastal waters, creating the coastal clade. This hypothesis is based on the relative resistance that freshwater shrimps have to saline environments reported for some species of Macrobrachium (Moreira et al., 1983; Freire et al., 2003). Although a strictly freshwater, or hololimnetic, species, its abundance in coastal basins and its relative resistance to saline environments (Holthuis, 1980) are indicative that M. jelskii might have dispersed throughout coastal basins and then colonized continental waters near the eastern Brazilian coast (Sergipe, Bahia and Espirito Santo states). A similar situation was observed for M. potiuna, whose juveniles show some resistance to temperature and salinity changes, so it is dispersed among coastal basins in periods of high rainfall (Moreira et al., 1983; Carvalho et al., 2013).

VERA-SILVA ET AL.: DISTRIBUTION AND GENETIC DIFFERENTIATION IN MACROBRACHIUM JELSKII

379

Fig. 6. Geographical distribution of Macrobrachium jelskii populations, showing the Amazonian and coastal clades. This figure is published in colour in the online edition of this journal, which can be accessed via http://booksandjournals.brillonline.com/content/journals/1937240x.

The second scenario takes into account climate change during the Miocene/Pliocene. By that time the climate had become warmer and drier and the sea level had dropped (Pellegrino et al., 2005; Dwyer and Chandler, 2008). This marine regression event probably led to river confluence at their lower courses throughout the Brazilian coast, and it is considered to be one of the ways freshwater fishes spread through South American basins (Costa, 2010). The dispersion of M. jelskii from the Amazon basin to the northeastern coast would have therefore been facilitated, later moving from north to south along the eastern coast and occupied coastal basins. The subsequent reestablishment of the sea level would have prevented the continuation of this flow by river confluence, isolating M. jelskii populations in distinct basins. The water salinity in these habitats would have

Downloaded from http://academic.oup.com/jcb/article-abstract/36/3/373/2548970 by guest on 13 April 2018

exceed the tolerance of M. jelskii, constituting a barrier to the species dispersal. Recent Events Macrobrachium jelskii populations of the Amazonian clade from distinct drainage basins show low genetic divergence. Considering the time of isolation in the basins where the Amazonian clade is found, this pattern of distribution would hardly be found if the occurrence of M. jelskii in those basins were natural. For example, the São Francisco basin was consolidated during the Neoproterozoic without evidence of communication with the Amazon basin since this period (Mabesoone and Neumann, 2005; Buckup, 2011). The Amazonian clade of M. jelskii is nevertheless found in both basins. The possibility of dispersion by human activi-

380

JOURNAL OF CRUSTACEAN BIOLOGY, VOL. 36, NO. 3, 2016

Fig. 7. Hypothetical dispersion events of Macrobrachium jelskii. The solid arrow indicates the likely dispersion that occurred before the Pliocene divergence from the center of origin in the Amazon basin. Dashed arrows represent the dispersion events cited in the literature: transplantation of Plagioscion squamosissimus from Brazilian northeastern reservoirs to southeast (longer arrow) and dispersion by commercial fishing preserves (shorter arrow). Dotted arrows illustrate dispersion from the Amazon basin to several areas by human activities. Regions indicated by outline: (1) Amazon, (2) northeastern Atlantic, (3) São Francisco, (4) east Atlantic, and (5) Paraná/Paraguay river basins. This figure is published in colour in the online edition of this journal, which can be accessed via http://booksandjournals.brillonline.com/content/journals/1937240x.

ties therefore must be considered because this species is used for fishing, the aquarium trade, and as food (Magalhães et al., 2005; Pileggi et al., 2013). The introduction of M. jelskii in aquaculture stations from CESP (Companhia Energética de São Paulo) between 1966 and 1973 were confirmed by Torloni et al. (1993). The introduction occurred as part of the transplantation process of a fish, the South American silver croaker Plagioscion squamosissimus (Heckel, 1840), from reservoirs from northeastern Brazil. By 1973, small individuals of the fish had reached reservoirs from Ilha Solteira and Jupiá, upper Paraná River, dispersing to Grande River af-

Downloaded from http://academic.oup.com/jcb/article-abstract/36/3/373/2548970 by guest on 13 April 2018

ter they had escaped from their previous environments in Pardo River in 1970. It is therefore possible that freshwater shrimps followed the same dispersion pattern (Magalhães et al., 2005). CESP also has dams at the upper Paraíba do Sul River basin, which could explain the occurrence of individuals from the Amazonian clade in the state of Rio de Janeiro. Magalhães et al. (2005) mentioned that M. jelskii could have also been brought to certain São Paulo localities by commercial (pay for, or “fish and pay”) fishing preserves from Pantanal populations because fishes from this region are used to populate pounds and reservoirs used in

VERA-SILVA ET AL.: DISTRIBUTION AND GENETIC DIFFERENTIATION IN MACROBRACHIUM JELSKII

these commercial activities. Larvae, juveniles, and immature forms of M. jelskii could also have been transported inadvertently with macrophyte roots, which are used as shelter for fishes during transportation in containers (see Montoya, 2003; Paschoal et al., 2013). The introduction and transference of fishes into inland waters has been taking place, whether intentionally or accidentally. The peacock bass, Cichla sp. (Bloch and Schneider, 1801), a carnivorous fish from the Amazon basin, is used in sport fishing and for food (Nascimento et al., 2001) and is currently widely distributed throughout Brazil. Native to the same basin, M. jelskii could have been transported along with this fish and other Amazonian species, either inadvertently as larvae or juveniles, or to be used as food or bait for fishes. Crustaceans, mainly species of Macrobrachium, are part of diet of carnivorous fishes (Santos et al., 2001). These likely events affecting the dispersal of M. jelskii are shown in Fig. 7. Considering human action as an important factor in the current distribution of M. jelskii, another possibility for the existence of a coastal clade, although unlikely, is that these populations could have been introduced from regions other than the Amazon basin. Vergamini et al. (2011) suggests the introduction of M. amazonicum from the Paraná and Paraguay hydrographic regions, which has a natural distribution and genetic structure similar to those of M. jelskii and is divided into three intraspecific clades. Magalhães et al. (2005) claimed that no negative ecological effects were reported within 60 years after M. jelskii introduction in northeastern Brazil. Despite the possibility of not causing environmental problems, however, there is the risk of “anthropogenic homogenization” (Souza et al., 2009) once the hybridization of populations is favored by the introduction (McNeely and Schutyser, 2003). The genetic diversity detected here in M. jelskii populations can be lost through time if continuous introduction by human activity (leading to homogenization) persists. Taxonomic Implications Even though it is possible to propose hypotheses to explain the current distribution of M. jelskii and suggest distinct evolutionary scenarios that would have led to the formation of two clades as shown by molecular analysis, the absence of consistent morphological characters (synapomorphies) precludes the description of a new taxon for the coastal clade of M. jelskii. It is possible, however, that such morphological differences do exist but were not detected. The two clades were the result of recent divergence, hence they might not yet been expressed by conspicuous morphological differences. The existence of cryptic species with likely differences in other biological characters is still possible. Ecological speciation has been already observed in other groups (Schluter, 2009), including a species of Macrobrachium (Carvalho et al., 2013). Studies on the habitat and lifestyle demonstrating ecological barriers between the two clades could help clarify the causes of this divergence, contributing to delimit a cryptic taxonomic entity and suggesting speciation into distinct ecological niches.

Downloaded from http://academic.oup.com/jcb/article-abstract/36/3/373/2548970 by guest on 13 April 2018

381

ACKNOWLEDGEMENTS This report is part of the undergraduate thesis of ALVS, who was supported by a scholarship from Conselho Nacional de Desenvolvimento Cientifico e Tecnológico (CNPq; no. 148306/2013-6). FLC was supported by a Ph.D. fellowship from CNPq (no. 140199/2011-0) and a Ph.D. fellowship from Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES; no. 7711-13-1). Major support for this project was provided by the Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP – Biota 2010/50188-8; scientific collections 2009/54931-0), by CNPq (research grant 472746/2004-9, 491490/2004-6, 473050/2007-2, and 471011/20118; research scholarships PQ 302748/2010-5 and 304968/2014-5) and by Ciências do Mar II (CAPES; no. 2005/2014-23038.004308/201414) to FLM. Partial support for Minas Gerais sampling activities was provided by Fundação de Amparo à Pesquisa do Estado de Minas Gerais (FAPEMIG; no. CRA-APQ-00159-08) under the responsibility of Giuliano B. Jacobucci (UFU). We thank Instituto Bios (INIBIO) and Projeto Piabanha for providing facilities during fieldwork in Bahia and Rio de Janeiro, respectively. We are grateful to many friends and colleagues for providing facilities during fieldwork, for providing essential fresh specimens, and for lending the materials from the collections used in our research and to members of the Laboratory of Bioecology and Crustacean Systematics (LBSC) for their help: Alexandre Almeida, Ligia Amadio, David Anderson, Tereza Calado, Irene Cardoso, Juliano Jacobucci, Vinicius Lampert, Gesuina Landim, Célio Magalhães, Emerson Mossolin, Nayara Neves, Caio Oliveira, Douglas Peiró, Isabela Pereira, Leonardo Pileggi, Rafael Robles, Natália Rossi, Edvanda Souza-Carvalho, and Lucas Torati. We also like to thank the anonymous reviewers for the valuable contributions that allowed improvements of the manuscript.

R EFERENCES Anger, K. 2013. Neotropical Macrobrachium (Caridea: Palaemonidae): on the biology, origin, and radiation of freshwater-invading shrimp. Journal of Crustacean Biology 33: 151-183. Baker, N., M. De Bruyn, and P. B. Mather. 2008. Patterns of molecular diversity in wild stocks of the redclaw crayfish (Cherax quadricarinatus) from northern Australia and Papua New Guinea: impacts of PlioPleistocene landscape evolution. Freshwater Biology 53: 1592-1605. Barros-Alves, S. P., A. C. Almeida, V. Fransozo, D. F. R. Alves, J. C. Silva, and V. J. Cobo. 2012. Population biology of the shrimp Macrobrachium jelskii (Miers, 1778) (Decapoda, Palaemonoidea) at the Grande River at northwest of the state of Minas Gerais, Brazil. Acta Limnologica Brasiliensia 24: 266-275. Boos, H., G. B. Buckup, L. Buckup, P. B. Araujo, C. Magalhães, M. P. Almerão, R. A. Santos, and F. L. Mantelatto. 2012. Checklist of the Crustacea from the state of Santa Catarina, Brazil. Check List 8(6): 10201046. Buckup, P. A. 2011. The eastern Brazilian shield, pp. 203-210. In, J. S. Albert and R. E. Reis (eds.), Historical Biogeography of Neotropical Freshwater Fishes. University of California Press, Berkeley, CA. Carvalho, F. L., C. Magalhães, and F. L. Mantelatto. 2014. Molecular and morphological differentiation between two Miocene-divergent lineages of Amazonian shrimps, with the description of a new species (Decapoda, Palaemonidae, Palaemon). ZooKeys 457: 79-108. , L. G. Pileggi, and F. L. Mantelatto. 2013. Molecular data raise the possibility of cryptic species in the Brazilian endemic prawn Macrobrachium potiuna (Decapoda, Palaemonidae). Latin American Journal of Aquatic Research 41: 707-717. Costa, L. F. C. 2010. Estudos de sistemática molecular e biogeografia histórica do bagre de água doce Pseudoplatystoma Bleeker, 1862 (Pimelodidae) na América do Sul. Ph.D. Thesis, Centro de Ciências Biológicas e da Saúde, Universidade Federal de São Carlos, São Carlos, Brazil. Crandall, K. A., and J. F. Fitzpatrick. 1996. Crayfish molecular systematics: using a combination of procedures to estimate phylogeny. Systematic Biology 45: 1-26. Darriba, D., G. L. Taboada, R. Doallo, and D. Posada. 2012. jModelTest 2: more models, new heuristics and parallel computing. Nature Methods 9: 772. De Grave, S., and C. W. Ashelby. 2013. A re-appraisal of the systematic status of selected genera in Palaemoninae (Crustacea: Decapoda: Palaemonidae). Zootaxa 3734: 331-344. Dwyer, G. S., and M. A. Chandler. 2008. Mid-Pliocene sea level and continental ice volume based on coupled benthic Mg/Ca palaeotemperatures

382

JOURNAL OF CRUSTACEAN BIOLOGY, VOL. 36, NO. 3, 2016

and oxygen isotopes. Philosophical Transactions of the Royal Society (London) 367: 157-168. Eno, N. C., R. A. Clark, and W. G. Sanderson. 1997. Non-native Marine Species in British Waters: a Review and Directory. Joint Nature Conservation Committee, Peterborough. Fausto Filho, J. 1967. Palaemon (Palaemon) paivai, nova espécie de Crustáceo do Brasil (Decapoda, Palaemonidae). Archivos da Estação de Biologia Marinha da Universidade Federal do Ceará (Brazil) 7: 19-22. Folmer, O., M. Black, W. Hoeh, R. Lutz, and R. Vrijenhoek. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294-299. Freire, C. A., F. Cavassin, E. N. Rodrigues, A. H. Torres, and J. C. McNamara. 2003. Adaptive patterns of osmotic and ionic regulation, and the invasion of fresh water by the palaemonid shrimps. Comparative Biochemistry and Physiology Part A: Molecular and Integrative Biology 136: 771-778. Gamba, A. L. 1984. Different egg-associated and larval development characteristics of Macrobrachium jelskii and M. amazonicum in a Venezuelan continental lagoon. International Journal of Invertebrate Reproduction and Development 7: 135-142. Gazola-Silva, F. F., S. G. Melo, and J. R. S. Vitule. 2007. Macrobrachium rosenbergii (Decapoda: Palaemonidae): possível introdução em um rio da planície litorânea paranaense (PR, Brasil). Acta Biológica Paranaense 36: 83-90. Gordon, I. 1935. On new or imperfectly known species of Crustacea Macrura. Journal of the Linnean Society of London (Zoology) 39: 307351. Gozlan, R. E. 2008. Introduction of non-native freshwater fish: is it all bad? Fish and Fisheries 9: 106-116. Hall, T. A. 2005. BioEdit 7.0.5. North Carolina State University, Department of Microbiology. Available online at http://www.mbio.ncsu.edu/ BioEdit/bioedit.html. Heller, C. 1862. Beiträge zur näheren Kenntnis der Macrouren. Sitzungsberichte der mathematisch-naturwissenschaftlichen Classe der Kaiserlichen Akademie der Wissenschaften in Wien 1862: 389-426. Holmes, S. J. 1895. Notes on West American Crustacea. Proceedings of the California Academy of Sciences 4: 563-588. Holthuis, L. B. 1950. Preliminary descriptions of twelve new species of palaemonid prawns from American waters (Crustacea Decapoda). Proceedings van de Koninklijke Nederlandsche Akademie van Wetenschappen 53: 93-99. . 1952. A General Revision of the Palaemonidae (Crustacea, Decapoda, Natantia) of the Americas: II. The Subfamily Palaemoninae. Allan Hancock Foundation Publication Occasional Paper 12: 1-396. . 1980. Shrimps and Prawns of the World: an Annotated Catalogue of Species of Interest to Fisheries. FAO Species Catalogue (Volume 1). FAO Fisheries Synopsis 125: 1-261. Jalihal, D. R., K. N. Sankolli, and S. Shenoy. 1993. Evolution of the larval development patterns and the process of freshwaterization in the prawn genus Macrobrachium Bate, 1868 (Decapoda, Palaemonidae). Crustaceana 65: 365-376. Katoh, K., and D. M. Standley. 2013. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Molecular Biology and Evolution 30: 772-780. Liu, M., Y. Cai, and C. Tzeng. 2007. Molecular systematics of the freshwater prawn genus Macrobrachium Bate, 1868 (Crustacea: Decapoda: Palaemonidae) inferred from mtDNA sequences with emphasis on East Asian species. Zoological Studies 46: 272-289. Mabesoone, J. M., and V. H. Neumann. 2005. Sedimentary basins of Brazilian borborema and São Francisco tectonic provinces since mesoproterozoic, pp. 191-234. In, J. M. Mabesoone and V. H. Neumann (eds.), Cyclic Development of Sedimentary Basins. Elsevier, Philadelphia, PA. Maciel, C. R., M. L. A. Quadros, F. A. Abrunhosa, S. N. B. Peixoto, H. Schneider, and M. I. C. Sampaio. 2011. Occurrence of the Indo-Pacific freshwater prawn Macrobrachium equidens Dana 1852 (Decapoda, Palaemonidae) on the coast of Brazilian Amazonia, with notes on its reproductive biology. Anais da Academia Brasileira de Ciências 83: 533544. Maddison, D. R. 2003. Are strepsipterans related to flies? Exploring longbranch attraction. Study 2. In, Mesquite: a Modular System for Evolutionary Analysis, Version 1.0. Available online at http://mesquiteproject. org.

Downloaded from http://academic.oup.com/jcb/article-abstract/36/3/373/2548970 by guest on 13 April 2018

Magalhães, C. 2002. Abbreviated larval development of Macrobrachium jelskii (Miers, 1877) (Crustacea: Decapoda: Palaemonidae) from the Rio Solimões floodplain, Amazonas, Brazil, reared in the laboratory. Nauplius 8: 1-15. , S. L. S. Bueno, G. Bond-Buckup, W. C. Valenti, H. L. M. Silva, F. Kiyohara, E. C. Mossolin, and S. S. Rocha. 2005. Exotic species of freshwater decapod crustacean in the state of São Paulo, Brazil: records and possible causes of their introduction. Biodiversity and Conservation 14: 1929-1945. Mantelatto, F. L., R. Robles, and D. L. Felder. 2007. Molecular phylogeny of the Western Atlantic species of the genus Portunus (Crustacea, Brachyura, Portunidae). Zoological Journal of the Linnean Society of London 150: 211-220. McNeely, J. A., and F. Schutyser. 2003. Invasive species: a global concern bubbling to the surface, pp. 1-14. In, International Conference on the Impact of Global Environmental Problems on Continental and Coastal Marine Waters, Geneva, Switzerland. Melo, G. A. S. 2003. Manual de identificação dos Crustacea Decapoda de água doce do Brasil. Loyola, São Paulo. Miers, E. J. 1877. Collection of Crustacea, Decapoda and Isopoda, chiefly from South America, with descriptions of new genera and species. Proceedings of the Zoological Society of London 1877: 653-679. Montoya, J. V. 2003. Freshwater shrimps of the genus Macrobrachium associated with roots of Eichhornia crassipes (water hyacinth) in the Orinoco Delta (Venezuela). Caribbean Journal of Science 39: 155-159. Moreira, G. S., J. C. McNamara, S. E. Shumway, and P. S. Moreira. 1983. Osmoregulation and respiratory metabolism in Brazilian Macrobrachium (Decapoda, Palaemonidae). Comparative Biochemistry and Physiology Part A: Molecular and Integrative Biology 74: 57-62. Müller, F. 1880. Palaemon potiuna. Ein Beispiel abgekürzter Verwandlung. Zoologischer Anzeiger 3: 152-157. Nascimento, F. L., A. C. Catella, and A. S. Moraes. 2001. Distribuição espacial do tucunaré, Cichla sp. (Pisces, Cichlidae), peixe amazônico introduzido no Pantanal, Brasil. Boletim de Pesquisa (Embrapa Pantanal, Corumbá, Brazil) 24: 1-15. Ottoni, F. P., A. Q. Lezama, M. L. Triques, E. N. Fragoso-Moura, C. C. T. Lucas, and F. A. R. Barbosa. 2011. Australoheros perdi, new species (Teleostei: Labroidei: Cichlidae) from the lacustrine region of the Doce River Valley, southeastern Brazil, with biological information. Vertebrate Zoology 61: 137-145. Paschoal, L. R. P., R. M. Souza, F. J. G. Guimarães, and E. C. G. Couto. 2013. Phytophilous caridean shrimps (Atyidae and Palaemonidae) in Salsa river (Canavieiras, Bahia, Brazil). Nauplius 21: 123-126. Pellegrino, K. C. M., M. T. Rodrigues, A. N. Waite, M. Morando, Y. Y. Yassuda, and J. W. Sites Jr. 2005. Phylogeography and species limits in the Gymnodactylus darwinii complex (Gekkonidae, Squamata): genetic structure coincides with river systems in the Brazilian Atlantic Forest. Biological Journal of the Linnean Society (London) 85: 13-26. Pereira, G. 1997. A cladistic analysis of the freshwater shrimps of the family Palaemonidae (Crustacea, Decapoda, Caridae). Acta Biologica Venezuelica 17: 1-69. Pileggi, L. G., C. Magalhães, G. Bond-Buckup, and F. L. Mantelatto. 2013. New records and extension of the known distribution of some freshwater shrimps in Brazil. Revista Mexicana de Biodiversidad 84: 563-574. , and F. L. Mantelatto. 2010. Molecular phylogeny of the freshwater prawn genus Macrobrachium (Decapoda, Palaemonidae) with emphasis on the relationships among selected American species. Invertebrate Systematics 24: 194-208. , and . 2012. Taxonomic revision of doubtful Brazilian freshwater shrimp species of genus Macrobrachium (Decapoda, Palaemonidae). Iheringia (Série Zoologia) 102: 426-437. Ronquist, F., M. Teslenko, P. Van Der Mark, D. Ayres, A. Darling, S. Höhna, B. Larget, L. Liu, M. A. Suchard, and J. P. Huelsenbeck. 2012. MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61: 539-542. Rossi, N., and F. L. Mantelatto. 2013. Molecular analysis of the freshwater prawn Macrobrachium olfersii (Decapoda: Palaemonidae) supports the existence of a single species throughout its distribution. PLoS ONE 8: e54698. Santos, L. N., A. F. Gonzalez, and F. G. Araújo. 2001. Dieta do tucunaréamarelo Cichla monoculus (Bloch and Schneider) (Osteichthyes, Cichlidae), no Reservatório de Lajes, Rio de Janeiro, Brasil. Revista Brasileira de Zoologia 18: 191-204.

VERA-SILVA ET AL.: DISTRIBUTION AND GENETIC DIFFERENTIATION IN MACROBRACHIUM JELSKII

Schluter, D. 2009. Evidence for ecological speciation and its alternative. Science 323: 737-741. Schubart, C. D., J. E. Neigel, and D. L. Felder. 2000. Use of the mitochondrial 16S rRNA gene for phylogenetic and population studies of Crustacea, pp. 817-830. In, J. C. von Vaupel Klein and F. R. Schram (eds.), The Biodiversity Crisis and Crustacea. Vol. 1. Crustacean Issues 12. A. A. Balkema, Rotterdam. Soares, M. R. S. 2008. Biologia populacional de Macrobrachium jelskii (Crustacea, Decapoda, Palaemonidae) na represa de Três Marias e no rio São Francisco, MG, Brasil. M.Sc. Thesis, Instituto de Biologia, Universidade Federal Rural do Rio de Janeiro, Rio de Janeiro. Souza, R. C. C. L., S. H. Calazans, and E. P. Silva. 2009. Impacto das espécies invasoras no ambiente aquático. Ciência e Cultura 61: 35-41. Stamatakis, A. 2006. RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22: 2688-2690. Tamura, K., D. Peterson, N. Peterson, G. Stecher, M. Nei, and S. Kumar. 2011. MEGA5: molecular evolutionary genetics analysis using maxi-

Downloaded from http://academic.oup.com/jcb/article-abstract/36/3/373/2548970 by guest on 13 April 2018

383

mum likelihood, evolutionary distance and maximum parsimony methods. Molecular Biology and Evolution 28: 2731-2739. Torloni, C. E. C., J. J. Santos, A. A. Carvalho Jr., and A. R. A. Corrêa. 1993. A Pescada-do-Piauí Plagioscion squamosissimus (Heckel, 1840) (Osteichthyes, Perciformes) Nos Reservatórios da Companhia Energética de São Paulo – CESP. CESP, Série Pesquisa e Desenvolvimento (São Paulo) 84. Vergamini, F. G., L. G. Pileggi, and F. L. Mantelatto. 2011. Genetic variability of the Amazon River prawn Macrobrachium amazonicum (Decapoda, Caridea, Palaemonidae). Contributions to Zoology (Amsterdam) 80: 6783. R ECEIVED: 4 November 2015. ACCEPTED: 5 February 2016. AVAILABLE ONLINE: 15 March 2016.

Loading...

Distribution and Genetic Differentiation of Macrobrachium Jelskii

J OURNAL OF C RUSTACEAN B IOLOGY, 36(3), 373-383, 2016 DISTRIBUTION AND GENETIC DIFFERENTIATION OF MACROBRACHIUM JELSKII (MIERS, 1877) (NATANTIA: PAL...

1MB Sizes 1 Downloads 10 Views

Recommend Documents

Genetic Diversity and Differentiation among Natural, Production, and
14625 C.R. 672, Wimauma, FL 33598. Madhugiri Nageswara Rao. University of Florida, IFAS, ..... Comparison of C. leavenwo

Identification, distribution and genetic diversity of the golden potato
Golden potato cyst nematode (Globodera rostochiensis (Wollenweber) Behrens) is a nematode species which has worldwide re

Cultivo de macrobrachium rosenbergii pdf
Jef puppets pointing his curse and syringes cultivo de secrecion faringea cocos gram positivos microscope! Hunting culti

spatial differentiation of socioeconomic and infrastructure - Core
2) Department of Urban & Regional Planning, Diponegoro University, Indonesia [email protected] ABSTRACT. Spatial diff

Monopolistic Competition And Product Differentiation
Use the three conditions for monopolistic competition discussed in the chapter to ... sumers. Because of the small numbe

Monopolistic Competition and Product Differentiation
important in oligopoly is no longer possible. We'll see in a moment how prices, output, and the number of products avail

Differentiation Defined - Wikibooks, open
1 What is Differentiation? 2 The Definition of Slope. 2.1 The slope Of a line; 2.2 Of a graph of a function; 2.3 Exercis

CHAPTER 3 Applications of Differentiation
12. 0.5 , 0. 15. P. VI. RI. I. I. I. = −. = −. ≤. ≤. 0. P = when. 0. I = 67.5. P = when. 15. I = 12. 0. P. I. â€

Differentiation of migrainous positional vertigo
El paciente fue tratado con maniobras de liberación para remover posible restos de otoconias del canal horizontal, en u

Genetic and Non-Genetic Analysis for Milk Production and
Faid-Allah E. 2015. Analisis faktor-faktor genetik dan non genetik sifat-sifat reproduksi dan produksi susu sapi Friesia